Review



consensus oligonucleotides for the ets (pu.1) sc-2549  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology consensus oligonucleotides for the ets (pu.1) sc-2549
    Consensus Oligonucleotides For The Ets (Pu.1) Sc 2549, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/consensus+oligonucleotides+for+the+ets++pu+1++sc+2549/pmc02626199-369-6-19
    Average 90 stars, based on 1 article reviews
    consensus oligonucleotides for the ets (pu.1) sc-2549 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Characterization of human glycoprotein VI gene 5' regulatory and promoter regions.
    Article Snippet: .. The following double-stranded competitors were similarly synthesized: GATA mutant (5 -GCCAGAGGAGAGCAGCGCGG-3 ), GATA consensus (5 -CACTTGATAACAGAAAGTGATAACTCT-3 ; GATA Gel Shift Oligonucleotides, Santa Cruz Biotechnology), Ets mutant (5 - CATCACACTTCGAGCCTGTG-3 ), Ets consensus (5 - GATCTCGAGCAGGAAGTTCGA-3 ; Ets-1/PEA3 Gel Shift Oligonucleotides, Santa Cruz Biotechnology), and PU.1 consensus (5 -GGGCTGCTTGAGGAAGTATAAGAAT-3 ; Ets Family Gel Shift Oligonucleotides, Santa Cruz Biotechnology). ..

    Mutagenesis:

    Article Title: Characterization of human glycoprotein VI gene 5' regulatory and promoter regions.
    Article Snippet: .. The following double-stranded competitors were similarly synthesized: GATA mutant (5 -GCCAGAGGAGAGCAGCGCGG-3 ), GATA consensus (5 -CACTTGATAACAGAAAGTGATAACTCT-3 ; GATA Gel Shift Oligonucleotides, Santa Cruz Biotechnology), Ets mutant (5 - CATCACACTTCGAGCCTGTG-3 ), Ets consensus (5 - GATCTCGAGCAGGAAGTTCGA-3 ; Ets-1/PEA3 Gel Shift Oligonucleotides, Santa Cruz Biotechnology), and PU.1 consensus (5 -GGGCTGCTTGAGGAAGTATAAGAAT-3 ; Ets Family Gel Shift Oligonucleotides, Santa Cruz Biotechnology). ..

    Gel Shift:

    Article Title: Characterization of human glycoprotein VI gene 5' regulatory and promoter regions.
    Article Snippet: .. The following double-stranded competitors were similarly synthesized: GATA mutant (5 -GCCAGAGGAGAGCAGCGCGG-3 ), GATA consensus (5 -CACTTGATAACAGAAAGTGATAACTCT-3 ; GATA Gel Shift Oligonucleotides, Santa Cruz Biotechnology), Ets mutant (5 - CATCACACTTCGAGCCTGTG-3 ), Ets consensus (5 - GATCTCGAGCAGGAAGTTCGA-3 ; Ets-1/PEA3 Gel Shift Oligonucleotides, Santa Cruz Biotechnology), and PU.1 consensus (5 -GGGCTGCTTGAGGAAGTATAAGAAT-3 ; Ets Family Gel Shift Oligonucleotides, Santa Cruz Biotechnology). ..



    Similar Products

    consensus tree  (ATCC)
    91
    ATCC consensus tree
    Consensus Tree, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/Aeromonas+schubertii+Hickman-Brenner+et+al/10__1094_slash_phyto___05___22___0151___r-123-2-30
    Average 91 stars, based on 1 article reviews
    consensus tree - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier
    g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp  (ATCC)
    94
    ATCC g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp
    G A C C 23s Rrna Consensus Rbs β Galactosidase Log2 Fold Change B Diminuta Atcc 11568 Bdim Rs13760 C Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/Brevundimonas+diminuta+(Leifson+and+Hugh)+Segers+et+al/pmc08144410__41467_2021_23362_MOESM1_ESM-90-139-153
    Average 94 stars, based on 1 article reviews
    g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase  (ATCC)
    96
    ATCC 29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase
    29149 Aayg Locus Consensus Description Gene Size Bp Protein Size Aa Rumgna 02411 Polyprenyl Glycosylphosphotransferase, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/Ruminococcus+gnavus+Moore+et+al/pmc08157926__pnas__2007595118__sapp-22-1-0
    Average 96 stars, based on 1 article reviews
    29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    consensus oligonucleotides for the ets (pu.1) sc-2549  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology consensus oligonucleotides for the ets (pu.1) sc-2549
    Consensus Oligonucleotides For The Ets (Pu.1) Sc 2549, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/consensus+oligonucleotides+for+the+ets++pu+1++sc+2549/pmc02626199-369-6-19
    Average 90 stars, based on 1 article reviews
    consensus oligonucleotides for the ets (pu.1) sc-2549 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ets consensus binding core  (Degnan Labs)
    90
    Degnan Labs ets consensus binding core
    Ets Consensus Binding Core, supplied by Degnan Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/ets+consensus+binding+core/pmc02668265-40-1-8
    Average 90 stars, based on 1 article reviews
    ets consensus binding core - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology 32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3
    32p Labelled Probes 506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, 506i 5'cggccgcgggaagcggccgcgggaagcagc'3 And Ets 1 Consensus 5'gatctcgagcaggaagttcga'3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/anti+ets1/10__1161_slash_atvbaha__107__140541-281-30-35
    Average 90 stars, based on 1 article reviews
    32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    oligomers containing either a consensus ets or nfκb binding element  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology oligomers containing either a consensus ets or nfκb binding element
    Oligomers Containing Either A Consensus Ets Or Nfκb Binding Element, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/oligomers+containing+either+a+consensus+ets+or+nf%CE%BAb+binding+element/pmc01526589-53-12-22
    Average 90 stars, based on 1 article reviews
    oligomers containing either a consensus ets or nfκb binding element - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    consensus et rpc recommandations pour la pratique clinique  (Janvier Labs)
    90
    Janvier Labs consensus et rpc recommandations pour la pratique clinique
    Consensus Et Rpc Recommandations Pour La Pratique Clinique, supplied by Janvier Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/consensus+et+rpc+recommandations+pour+la+pratique+clinique/pm15752673-7-5-19
    Average 90 stars, based on 1 article reviews
    consensus et rpc recommandations pour la pratique clinique - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ets-1/pea3 consensus double-strand oligonucleotides  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology ets-1/pea3 consensus double-strand oligonucleotides
    Ets 1/Pea3 Consensus Double Strand Oligonucleotides, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/c+ebp+consensus+oligonucleotide/10__1042_slash_bj20041024-76-43-47
    Average 90 stars, based on 1 article reviews
    ets-1/pea3 consensus double-strand oligonucleotides - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ets-1 consensus probes with or without mutation  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology ets-1 consensus probes with or without mutation
    Ets 1 Consensus Probes With Or Without Mutation, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ets+consensus/anti+ets1/pm15459902-151-6-16
    Average 90 stars, based on 1 article reviews
    ets-1 consensus probes with or without mutation - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results